Review



human par2  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    R&D Systems human par2
    Human Par2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+par2+versaclone+cdna/Human+PAR2+(NP_005233)+VersaClone+cDNA/pm28445455-237-23-25
    Average 90 stars, based on 1 article reviews
    human par2 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Expressing:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Plasmid Preparation:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Construct:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Polymerase Chain Reaction:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Generated:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).

    Subcloning:

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
    Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).



    Similar Products

    90
    R&D Systems Hematology human par2 versaclone cdna
    The collagenases are able to cleave the <t>PAR2</t> extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).
    Human Par2 Versaclone Cdna, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+par2+versaclone+cdna/Human+PAR2+(NP_005233)+VersaClone+cDNA/pmc06664178-241-21-26
    Average 90 stars, based on 1 article reviews
    human par2 versaclone cdna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    R&D Systems Hematology human par2 pcr product
    The collagenases are able to cleave the <t>PAR2</t> extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).
    Human Par2 Pcr Product, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+par2+versaclone+cdna/Human+PAR2+(NP_005233)+VersaClone+cDNA/pmc06664178-291-10-22
    Average 90 stars, based on 1 article reviews
    human par2 pcr product - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    R&D Systems human par2
    The collagenases are able to cleave the <t>PAR2</t> extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).
    Human Par2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+par2+versaclone+cdna/Human+PAR2+(NP_005233)+VersaClone+cDNA/pm28445455-237-23-25
    Average 90 stars, based on 1 article reviews
    human par2 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    The collagenases are able to cleave the PAR2 extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The collagenases are able to cleave the PAR2 extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Produced, Activation Assay, Sequencing, Incubation, Silver Staining, Recombinant

    The MMP collagenases cleave PAR2 at a novel site. The PAR231–72 peptide (10 μm) was incubated with APMA-activated MMP-1 (400 nm; A), MMP-8 (20 nm; B), or MMP-13 (200 nm; C) for 24 h, and reversed-phase HPLC was performed. HPLC chromatograms are representative of at least two independent experiments and are presented as separate graphs for clarity with the same control chromatogram presented in each panel. Peaks identified by HPLC were collected and subjected to further analysis by electrospray MS, which identified MMP-derived cleavage sites at Ser37-Leu38 and Val68-Leu69, to reveal a putative neoepitope-tethered ligand (underlined in D). The colored arrows (A–C) and lines (D) indicate the following: red, parent peptide; green, Ser37-Leu38 cleavage; amber, Val68-Leu69 cleavage; blue, Ser37-Leu38 and Val68-Leu69 cleavage. Observed masses are presented in Table S1. mAU, milli-absorbance units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The MMP collagenases cleave PAR2 at a novel site. The PAR231–72 peptide (10 μm) was incubated with APMA-activated MMP-1 (400 nm; A), MMP-8 (20 nm; B), or MMP-13 (200 nm; C) for 24 h, and reversed-phase HPLC was performed. HPLC chromatograms are representative of at least two independent experiments and are presented as separate graphs for clarity with the same control chromatogram presented in each panel. Peaks identified by HPLC were collected and subjected to further analysis by electrospray MS, which identified MMP-derived cleavage sites at Ser37-Leu38 and Val68-Leu69, to reveal a putative neoepitope-tethered ligand (underlined in D). The colored arrows (A–C) and lines (D) indicate the following: red, parent peptide; green, Ser37-Leu38 cleavage; amber, Val68-Leu69 cleavage; blue, Ser37-Leu38 and Val68-Leu69 cleavage. Observed masses are presented in Table S1. mAU, milli-absorbance units.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Incubation, Control, Derivative Assay

    The collagenases cleave PAR2 with varying efficiencies. 2-Abz-SKGRSLIG-Y(NO2) peptide (10 μm) was incubated with day 14 conditioned media from IL-1 + OSM-stimulated bovine nasal cartilage explant cultures in the presence or absence of 100 μm GM6001, 10 μm E64, or 2 mm diisopropyl fluorophosphate (DFP). Data (mean ± S.D.) are normalized to the no-inhibitor control sample and are representative of at least two independent experiments with conditioned media from different cartilages (A). 2-Abz-SKGRSLIG-Y(NO2) peptide (50 μm) was incubated with APMA-activated recombinant pro-MMP-1 (50 nm), -8 (10 nm), or -13 (20 nm) in the presence or absence of 50 μm GM6001 or DMSO-only control, and data were normalized to the inhibitor/DMSO negative sample (mean ± S.D.), combining means (each with n = 2 technical replicates) from four independent experiments (B). Michaelis–Menten curves (mean ± S.D.; presented graphs show combined means (each with n = 2 technical replicates) of three independent experiments) were generated using TIMP-1–titrated APMA-activated recombinant pro-MMP-1, -8, and -13 (C). The hydrolysis of substrate was quantified (nm·s−1) using a standard curve determined by total substrate hydrolysis, and nonlinear regression analysis was performed to generate kinetic constants Km and Vmax. kcat was subsequently calculated from Vmax and active enzyme concentration. Tabulated kinetic constants (mean ± S.D.) are from three independent experiments. Matriptase kinetic parameters are included for comparison (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The collagenases cleave PAR2 with varying efficiencies. 2-Abz-SKGRSLIG-Y(NO2) peptide (10 μm) was incubated with day 14 conditioned media from IL-1 + OSM-stimulated bovine nasal cartilage explant cultures in the presence or absence of 100 μm GM6001, 10 μm E64, or 2 mm diisopropyl fluorophosphate (DFP). Data (mean ± S.D.) are normalized to the no-inhibitor control sample and are representative of at least two independent experiments with conditioned media from different cartilages (A). 2-Abz-SKGRSLIG-Y(NO2) peptide (50 μm) was incubated with APMA-activated recombinant pro-MMP-1 (50 nm), -8 (10 nm), or -13 (20 nm) in the presence or absence of 50 μm GM6001 or DMSO-only control, and data were normalized to the inhibitor/DMSO negative sample (mean ± S.D.), combining means (each with n = 2 technical replicates) from four independent experiments (B). Michaelis–Menten curves (mean ± S.D.; presented graphs show combined means (each with n = 2 technical replicates) of three independent experiments) were generated using TIMP-1–titrated APMA-activated recombinant pro-MMP-1, -8, and -13 (C). The hydrolysis of substrate was quantified (nm·s−1) using a standard curve determined by total substrate hydrolysis, and nonlinear regression analysis was performed to generate kinetic constants Km and Vmax. kcat was subsequently calculated from Vmax and active enzyme concentration. Tabulated kinetic constants (mean ± S.D.) are from three independent experiments. Matriptase kinetic parameters are included for comparison (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Incubation, Control, Recombinant, Generated, Concentration Assay, Comparison, Two Tailed Test

    Activation of PAR2 by the canonical activator peptide SLIGKV-NH2 results in MMP1, MMP13, and ATF3 expression. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–10 μm SLIGKVD-NH2 (injected at arrow S) followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2 for the indicated times, and RT-qPCR was performed for ATF3 (B) and MMP1 and MMP13 (C). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 4) and are representative of two independent experiments. SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 for 48 h, and the conditioned medium was used to perform MMP-1 and MMP-13 ELISAs. Data are presented as mean ± S.D. and are representative of three independent experiments (each with n = 6 technical replicates) (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests against basal (unstimulated) where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05 for MMP1 and ATF3 and ### indicates p < 0.001, ## indicates p < 0.01, and # indicates p < 0.05 for MMP13. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: Activation of PAR2 by the canonical activator peptide SLIGKV-NH2 results in MMP1, MMP13, and ATF3 expression. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–10 μm SLIGKVD-NH2 (injected at arrow S) followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2 for the indicated times, and RT-qPCR was performed for ATF3 (B) and MMP1 and MMP13 (C). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 4) and are representative of two independent experiments. SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 for 48 h, and the conditioned medium was used to perform MMP-1 and MMP-13 ELISAs. Data are presented as mean ± S.D. and are representative of three independent experiments (each with n = 6 technical replicates) (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests against basal (unstimulated) where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05 for MMP1 and ATF3 and ### indicates p < 0.001, ## indicates p < 0.01, and # indicates p < 0.05 for MMP13. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Expressing, Plasmid Preparation, Control, Injection, Fluorescence, Quantitative RT-PCR, Two Tailed Test

    LIGKVD-NH2 is not a canonical PAR2 activator. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–100 μm LIGKVD-NH2 (left panel) or DVKGIL-NH2 (right panel) and injected at arrow L or D, respectively, followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2, 100 μm LIGKVD-NH2, 100 μm DVKGIL-NH2, or 50 nm matriptase for 90 min (left panel) or 24 h (right panel), and RT-qPCR was performed for ATF3 or MMP1. Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of three independent experiments (B). SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 (C), 100 μm LIGKVD-NH2 (D), or 100 μm DVKGIL-NH2 (E) for the indicated times, and then cell lysates were immunoblotted for phospho-ERK1/2 (p-ERK1/2), ERK1/2, phospho-p38 (p-p38), or p38. Combined densitometric scans of three independent experiments (mean ± S.D.) are presented. Statistical comparisons were performed using Student's two-tailed unpaired t tests comparing stimulated cells with basal where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: LIGKVD-NH2 is not a canonical PAR2 activator. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–100 μm LIGKVD-NH2 (left panel) or DVKGIL-NH2 (right panel) and injected at arrow L or D, respectively, followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2, 100 μm LIGKVD-NH2, 100 μm DVKGIL-NH2, or 50 nm matriptase for 90 min (left panel) or 24 h (right panel), and RT-qPCR was performed for ATF3 or MMP1. Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of three independent experiments (B). SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 (C), 100 μm LIGKVD-NH2 (D), or 100 μm DVKGIL-NH2 (E) for the indicated times, and then cell lysates were immunoblotted for phospho-ERK1/2 (p-ERK1/2), ERK1/2, phospho-p38 (p-p38), or p38. Combined densitometric scans of three independent experiments (mean ± S.D.) are presented. Statistical comparisons were performed using Student's two-tailed unpaired t tests comparing stimulated cells with basal where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Plasmid Preparation, Control, Injection, Fluorescence, Quantitative RT-PCR, Expressing, Two Tailed Test

    MMP-1 is antagonistic to canonical PAR2 activation. SW1353-PAR2 cells were pretreated with either 1000 nm active MMP-1 or serum-free medium for 120 min prior to the addition of 10 nm matriptase or 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (A). SW1353-PAR2 or empty vector control cells were stimulated with either 1000 nm active MMP-1 or 100 μm SLIGKV-NH2 for 60 min, and RT-qPCR was performed for ATF3 (B). SW1353-PAR2 cells were pretreated with 100 μm LIGKVD-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (C). SW1353-PAR2 cells were pretreated with 100 μm DVKGIL-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (D). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of at least three independent experiments. Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: MMP-1 is antagonistic to canonical PAR2 activation. SW1353-PAR2 cells were pretreated with either 1000 nm active MMP-1 or serum-free medium for 120 min prior to the addition of 10 nm matriptase or 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (A). SW1353-PAR2 or empty vector control cells were stimulated with either 1000 nm active MMP-1 or 100 μm SLIGKV-NH2 for 60 min, and RT-qPCR was performed for ATF3 (B). SW1353-PAR2 cells were pretreated with 100 μm LIGKVD-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (C). SW1353-PAR2 cells were pretreated with 100 μm DVKGIL-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (D). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of at least three independent experiments. Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Quantitative RT-PCR, Plasmid Preparation, Control, Expressing, Two Tailed Test

    Collagenolytic MMPs are induced by PAR2 activation and can antagonize further PAR2 activation. Data presented within this study demonstrate that canonical PAR2 activation is able to induce MMP1 and MMP13 expression and subsequent secretion from chondrocytes, and the addition of MMP-1 to chondrocytes prior to canonical proteolytic stimulation results in an attenuated activation potential of PAR2.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: Collagenolytic MMPs are induced by PAR2 activation and can antagonize further PAR2 activation. Data presented within this study demonstrate that canonical PAR2 activation is able to induce MMP1 and MMP13 expression and subsequent secretion from chondrocytes, and the addition of MMP-1 to chondrocytes prior to canonical proteolytic stimulation results in an attenuated activation potential of PAR2.

    Article Snippet: Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Expressing

    The collagenases are able to cleave the PAR2 extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The collagenases are able to cleave the PAR2 extracellular domain. A 42-amino-acid peptide corresponding to Arg31–Lys72 of the extracellular domain of PAR2 (denoted in red) was produced. Various known cleavage sites are highlighted: the canonical activation site (trypsin, matriptase, etc., with the tethered ligand/activator peptide sequence underlined); CS, cathepsin S; PR3, proteinase 3; CG, cathepsin G; NE, neutrophil elastase (A). The PAR231–72 peptide (10 μm) was incubated with 10 nm hepsin or elastase, 1 nm cathepsin G, or 0.1 nm matriptase for the indicated durations before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. Presented gels are representative of at least two independent experiments (B). The PAR231–72 peptide (10 μm) was incubated with increasing concentrations of APMA-activated recombinant pro-MMP-1, -8, and -13 for 24 h before resolving on 20% polyacrylamide gels utilizing a Tris-Tricine buffer system and silver staining. S, substrate; P, product. The presented gels are representative of three independent experiments (C).

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Produced, Activation Assay, Sequencing, Incubation, Silver Staining, Recombinant

    The MMP collagenases cleave PAR2 at a novel site. The PAR231–72 peptide (10 μm) was incubated with APMA-activated MMP-1 (400 nm; A), MMP-8 (20 nm; B), or MMP-13 (200 nm; C) for 24 h, and reversed-phase HPLC was performed. HPLC chromatograms are representative of at least two independent experiments and are presented as separate graphs for clarity with the same control chromatogram presented in each panel. Peaks identified by HPLC were collected and subjected to further analysis by electrospray MS, which identified MMP-derived cleavage sites at Ser37-Leu38 and Val68-Leu69, to reveal a putative neoepitope-tethered ligand (underlined in D). The colored arrows (A–C) and lines (D) indicate the following: red, parent peptide; green, Ser37-Leu38 cleavage; amber, Val68-Leu69 cleavage; blue, Ser37-Leu38 and Val68-Leu69 cleavage. Observed masses are presented in Table S1. mAU, milli-absorbance units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The MMP collagenases cleave PAR2 at a novel site. The PAR231–72 peptide (10 μm) was incubated with APMA-activated MMP-1 (400 nm; A), MMP-8 (20 nm; B), or MMP-13 (200 nm; C) for 24 h, and reversed-phase HPLC was performed. HPLC chromatograms are representative of at least two independent experiments and are presented as separate graphs for clarity with the same control chromatogram presented in each panel. Peaks identified by HPLC were collected and subjected to further analysis by electrospray MS, which identified MMP-derived cleavage sites at Ser37-Leu38 and Val68-Leu69, to reveal a putative neoepitope-tethered ligand (underlined in D). The colored arrows (A–C) and lines (D) indicate the following: red, parent peptide; green, Ser37-Leu38 cleavage; amber, Val68-Leu69 cleavage; blue, Ser37-Leu38 and Val68-Leu69 cleavage. Observed masses are presented in Table S1. mAU, milli-absorbance units.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Incubation, Control, Derivative Assay

    The collagenases cleave PAR2 with varying efficiencies. 2-Abz-SKGRSLIG-Y(NO2) peptide (10 μm) was incubated with day 14 conditioned media from IL-1 + OSM-stimulated bovine nasal cartilage explant cultures in the presence or absence of 100 μm GM6001, 10 μm E64, or 2 mm diisopropyl fluorophosphate (DFP). Data (mean ± S.D.) are normalized to the no-inhibitor control sample and are representative of at least two independent experiments with conditioned media from different cartilages (A). 2-Abz-SKGRSLIG-Y(NO2) peptide (50 μm) was incubated with APMA-activated recombinant pro-MMP-1 (50 nm), -8 (10 nm), or -13 (20 nm) in the presence or absence of 50 μm GM6001 or DMSO-only control, and data were normalized to the inhibitor/DMSO negative sample (mean ± S.D.), combining means (each with n = 2 technical replicates) from four independent experiments (B). Michaelis–Menten curves (mean ± S.D.; presented graphs show combined means (each with n = 2 technical replicates) of three independent experiments) were generated using TIMP-1–titrated APMA-activated recombinant pro-MMP-1, -8, and -13 (C). The hydrolysis of substrate was quantified (nm·s−1) using a standard curve determined by total substrate hydrolysis, and nonlinear regression analysis was performed to generate kinetic constants Km and Vmax. kcat was subsequently calculated from Vmax and active enzyme concentration. Tabulated kinetic constants (mean ± S.D.) are from three independent experiments. Matriptase kinetic parameters are included for comparison (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: The collagenases cleave PAR2 with varying efficiencies. 2-Abz-SKGRSLIG-Y(NO2) peptide (10 μm) was incubated with day 14 conditioned media from IL-1 + OSM-stimulated bovine nasal cartilage explant cultures in the presence or absence of 100 μm GM6001, 10 μm E64, or 2 mm diisopropyl fluorophosphate (DFP). Data (mean ± S.D.) are normalized to the no-inhibitor control sample and are representative of at least two independent experiments with conditioned media from different cartilages (A). 2-Abz-SKGRSLIG-Y(NO2) peptide (50 μm) was incubated with APMA-activated recombinant pro-MMP-1 (50 nm), -8 (10 nm), or -13 (20 nm) in the presence or absence of 50 μm GM6001 or DMSO-only control, and data were normalized to the inhibitor/DMSO negative sample (mean ± S.D.), combining means (each with n = 2 technical replicates) from four independent experiments (B). Michaelis–Menten curves (mean ± S.D.; presented graphs show combined means (each with n = 2 technical replicates) of three independent experiments) were generated using TIMP-1–titrated APMA-activated recombinant pro-MMP-1, -8, and -13 (C). The hydrolysis of substrate was quantified (nm·s−1) using a standard curve determined by total substrate hydrolysis, and nonlinear regression analysis was performed to generate kinetic constants Km and Vmax. kcat was subsequently calculated from Vmax and active enzyme concentration. Tabulated kinetic constants (mean ± S.D.) are from three independent experiments. Matriptase kinetic parameters are included for comparison (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Incubation, Control, Recombinant, Generated, Concentration Assay, Comparison, Two Tailed Test

    Activation of PAR2 by the canonical activator peptide SLIGKV-NH2 results in MMP1, MMP13, and ATF3 expression. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–10 μm SLIGKVD-NH2 (injected at arrow S) followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2 for the indicated times, and RT-qPCR was performed for ATF3 (B) and MMP1 and MMP13 (C). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 4) and are representative of two independent experiments. SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 for 48 h, and the conditioned medium was used to perform MMP-1 and MMP-13 ELISAs. Data are presented as mean ± S.D. and are representative of three independent experiments (each with n = 6 technical replicates) (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests against basal (unstimulated) where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05 for MMP1 and ATF3 and ### indicates p < 0.001, ## indicates p < 0.01, and # indicates p < 0.05 for MMP13. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: Activation of PAR2 by the canonical activator peptide SLIGKV-NH2 results in MMP1, MMP13, and ATF3 expression. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–10 μm SLIGKVD-NH2 (injected at arrow S) followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2 for the indicated times, and RT-qPCR was performed for ATF3 (B) and MMP1 and MMP13 (C). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 4) and are representative of two independent experiments. SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 for 48 h, and the conditioned medium was used to perform MMP-1 and MMP-13 ELISAs. Data are presented as mean ± S.D. and are representative of three independent experiments (each with n = 6 technical replicates) (D). Selected statistical comparisons were performed using Student's two-tailed unpaired t tests against basal (unstimulated) where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05 for MMP1 and ATF3 and ### indicates p < 0.001, ## indicates p < 0.01, and # indicates p < 0.05 for MMP13. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Expressing, Plasmid Preparation, Control, Injection, Fluorescence, Quantitative RT-PCR, Two Tailed Test

    LIGKVD-NH2 is not a canonical PAR2 activator. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–100 μm LIGKVD-NH2 (left panel) or DVKGIL-NH2 (right panel) and injected at arrow L or D, respectively, followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2, 100 μm LIGKVD-NH2, 100 μm DVKGIL-NH2, or 50 nm matriptase for 90 min (left panel) or 24 h (right panel), and RT-qPCR was performed for ATF3 or MMP1. Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of three independent experiments (B). SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 (C), 100 μm LIGKVD-NH2 (D), or 100 μm DVKGIL-NH2 (E) for the indicated times, and then cell lysates were immunoblotted for phospho-ERK1/2 (p-ERK1/2), ERK1/2, phospho-p38 (p-p38), or p38. Combined densitometric scans of three independent experiments (mean ± S.D.) are presented. Statistical comparisons were performed using Student's two-tailed unpaired t tests comparing stimulated cells with basal where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: LIGKVD-NH2 is not a canonical PAR2 activator. SW1353-PAR2 cells (blue lines) or empty vector control cells (red lines) loaded with Rhod-4-AM fluorescent calcium probe were subjected to titrations of 0–100 μm LIGKVD-NH2 (left panel) or DVKGIL-NH2 (right panel) and injected at arrow L or D, respectively, followed by 5 μm ionomycin (injected at arrow Io), and calcium mobilization was measured. Data are presented relative to basal fluorescence (at 0 s) and are representative of two independent experiments (each with n = 3 technical replicates) (A). SW1353-PAR2 cells were stimulated with 100 μm SLIGKV-NH2, 100 μm LIGKVD-NH2, 100 μm DVKGIL-NH2, or 50 nm matriptase for 90 min (left panel) or 24 h (right panel), and RT-qPCR was performed for ATF3 or MMP1. Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of three independent experiments (B). SW1353-PAR2 or empty vector control cells were stimulated with 100 μm SLIGKV-NH2 (C), 100 μm LIGKVD-NH2 (D), or 100 μm DVKGIL-NH2 (E) for the indicated times, and then cell lysates were immunoblotted for phospho-ERK1/2 (p-ERK1/2), ERK1/2, phospho-p38 (p-p38), or p38. Combined densitometric scans of three independent experiments (mean ± S.D.) are presented. Statistical comparisons were performed using Student's two-tailed unpaired t tests comparing stimulated cells with basal where *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05. All error bars represent S.D. AFU, arbitrary fluorescence units.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Plasmid Preparation, Control, Injection, Fluorescence, Quantitative RT-PCR, Expressing, Two Tailed Test

    MMP-1 is antagonistic to canonical PAR2 activation. SW1353-PAR2 cells were pretreated with either 1000 nm active MMP-1 or serum-free medium for 120 min prior to the addition of 10 nm matriptase or 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (A). SW1353-PAR2 or empty vector control cells were stimulated with either 1000 nm active MMP-1 or 100 μm SLIGKV-NH2 for 60 min, and RT-qPCR was performed for ATF3 (B). SW1353-PAR2 cells were pretreated with 100 μm LIGKVD-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (C). SW1353-PAR2 cells were pretreated with 100 μm DVKGIL-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (D). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of at least three independent experiments. Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: MMP-1 is antagonistic to canonical PAR2 activation. SW1353-PAR2 cells were pretreated with either 1000 nm active MMP-1 or serum-free medium for 120 min prior to the addition of 10 nm matriptase or 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (A). SW1353-PAR2 or empty vector control cells were stimulated with either 1000 nm active MMP-1 or 100 μm SLIGKV-NH2 for 60 min, and RT-qPCR was performed for ATF3 (B). SW1353-PAR2 cells were pretreated with 100 μm LIGKVD-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (C). SW1353-PAR2 cells were pretreated with 100 μm DVKGIL-NH2 or serum-free medium for 120 min prior to the addition of 100 μm SLIGKV-NH2 for an additional 60 min, and RT-qPCR was performed for ATF3 (D). Data are expressed relative to GAPDH and presented as -fold change compared with basal expression (mean ± S.D., n = 6) and are representative of at least three independent experiments. Selected statistical comparisons were performed using Student's two-tailed unpaired t tests where *** indicates p < 0.001. All error bars represent S.D.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Quantitative RT-PCR, Plasmid Preparation, Control, Expressing, Two Tailed Test

    Collagenolytic MMPs are induced by PAR2 activation and can antagonize further PAR2 activation. Data presented within this study demonstrate that canonical PAR2 activation is able to induce MMP1 and MMP13 expression and subsequent secretion from chondrocytes, and the addition of MMP-1 to chondrocytes prior to canonical proteolytic stimulation results in an attenuated activation potential of PAR2.

    Journal: The Journal of Biological Chemistry

    Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover

    doi: 10.1074/jbc.RA119.006974

    Figure Lengend Snippet: Collagenolytic MMPs are induced by PAR2 activation and can antagonize further PAR2 activation. Data presented within this study demonstrate that canonical PAR2 activation is able to induce MMP1 and MMP13 expression and subsequent secretion from chondrocytes, and the addition of MMP-1 to chondrocytes prior to canonical proteolytic stimulation results in an attenuated activation potential of PAR2.

    Article Snippet: The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK).

    Techniques: Activation Assay, Expressing