Transduction:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Expressing:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Plasmid Preparation:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Construct:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Polymerase Chain Reaction:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Generated:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction— The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with primers: For, 5’-AAAA GGATCCGCCACCATGCGGAGCCCCAGC3’ and Rev, 5’-GCGCGGCCGCGGATCCTC AATAGGAGGTCTTAACAGTGGTTGAAC-3’ prior to routine sub-cloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMV∆8.91 and pVSV-G (both supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols, and concentrated using the Lenti-X kit (ClonTech, Mountain View, USA).
Subcloning:Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. Lentivirus generation and transduction The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
Article Title: Collagenolytic matrix metalloproteinases antagonize proteinase-activated receptor-2 activation, providing insights into extracellular matrix turnover
Article Snippet: .. The lentiviral expression plasmid pSIEW-hPAR2 was constructed using a BamHI-tagged human PAR2 PCR product generated from the human PAR2 VersaClone cDNA (RDC0166, R&D Biosystems) with the primers 5′-AAAAGGATCCGCCACCATGCGGAGCCCCAGC-3′ (forward) and 5′-GCGCGGCCGCGGATCCTCAATAGGAGGTCTTAACAGTGGTTGAAC-3′ (reverse) prior to routine subcloning into BamHI-digested pHR-SINcPPT-SIEW (a generous gift from Prof. Olaf Heidenreich, Newcastle University, UK). .. Lentiviruses were generated in HEK293T cells following transfection with pSIEW-hPAR2, pCMVΔ8.91, and pVSV-G (the latter two supplied by Prof. Heidenreich, Newcastle University, UK) according to standard protocols and concentrated using the Lenti-X kit (Clontech).
|